Skip to main content

Table 1 The information on primer and probe of RAA assay

From: A rapid and sensitive recombinase aided amplification assay to detect hepatitis B virus without DNA extraction

Primer/probe Sequence (5′-3′) Genomic position Product size (bp)
F-primer ATTCGCATGCCCCAACCTCAATCACTCACC 311–342 443
R-primer AATACCACATCATCCATATAACTGAAAGCC 721–751
Probe TATCATCTTCCTCTTCATCCTGCTGCTATGCCTCA [FAM-DT][THF][BHQ-DT] TCTTGTT GGTTC [C3-spacer] 391–441
  1. Footnote; probe modifications: FAM, 6-carboxyfluorescein; THF, tetrahydrofuran; BHQ, black hole quencher; C3-spacer, 3′ phosphate blocker