Skip to main content

Table 1 Oligonucleotide primers for molecular confirmation of GBS

From: Prevalence and capsular type distribution of Streptococcus agalactiae isolated from pregnant women in Namibia and South Africa

Name scpBF
Sequence ACAACGGAAGGCGCTACTGTTC
Name scpBR
Sequence ACCTGGTGTTTGACCTGAACTA
  1. (Adopted from Elbaradie et al., 2009) [37]