Skip to main content

Table 1 Primers and probes used in this study

From: Rapid molecular detection of macrolide resistance

Name Sequence
mefA_RPA_F1 5’-GCGGTTACGCCACTTTTAGTACCAGAAGAACAGCT-3’
mefA_RPA_R1 5′-[Biotin]-TTTAGTTCCCAAACGGAGTATAAGAGTGCTGCAAC-3’
mefA_RPA_probe 5′−/56-FAM/CAGGCTATAGTCAGTCTTTGCAGTCTATAAGC/idSp/ATATTGTTAGTCCGGC/3IABkFQ/− 3’
27F 5’-AGAGTTTGATCCTGGCTCAG-3’
388R 5’-TGCTGCCTCCCGTAGGAGT-3’
\