Skip to main content

Table 2 Sequence of utilized primers in this study

From: Identification of nine cryptic species of Candida albicans, C. glabrata, and C. parapsilosis complexes using one-step multiplex PCR

Primer Name Primer sequences Annotation
PACF GCTACCACTTCAGAATCATCATC Universal forward (PACF) and reverse (PACR) primers for C. albicans, C. dubliniensis and C. africana
PGCF TCACTTTCAACTGCTTTCGC Universal forward primers for C. glabrata, C. nivariensis and C. bracarensis
GR TGCGAGTCATGGGCGGAA Reverse primer only for C. glabrata
NR ACCCCAGAGGCATAAATAGC Reverse primer only for C. nivariensis
BR GCAACTGGACGAAAGTGC Reverse primer only for C. bracarensis
PF GCGGAAGGATCATTACAGAATG Forward (PF) and reverse (PR) primers specifically for C. parapsilosis
OMF GAGAAAGCACGCCTCTTTGC Universal forward (OMF) and reverse (OMR) primers for C. orthopsilosis and C. metapsilosis