Skip to main content

Table 1 Primers and probes used in the multiplex qRT-PCR assay

From: Development of a quadruple qRT-PCR assay for simultaneous identification of highly and low pathogenic H7N9 avian influenza viruses and characterization against oseltamivir resistance

Primers/probes Sequences (5′-3′)a Genome positionsb Final concentration (nM)
H7-F GGRAAATGYCCRAGATATGTTAA 934–956 600
H7-R AATTAGKCCTTCCCATCCATTT 1062–1083 600
H7-P-W ROX-TTGGTGCYATAGCDGGTTTCATTGA-BHQ2 1037–1061 600
H7-P-M FAM-AGRGAAAACGGRYTGCGA-MGB 1010–1027 800
N9-F GAAGAATGCTCATGTTACGG 832–851 400
N9-R TGACTAGTGTGTGTCATTGCTA 929–950 400
N9-P-W Cy5-ATTGGCAGGGCTCAAATAGACCAGT-BHQ3 887–911 400
N9-P-M VIC-GCACATGCAAGGACA-MGB 872–886 400
  1. aFAM, 6-carboxyfluorescein; Cy5, cyanine 5; ROX, 6-carboxy-X-rhodamine; MGB, minor groove binding; BHQ, Black Hole Quencher; Y = T or C, R = A or G, K = G or T, D = A or T or G
  2. bNucleotide position is based on the ORF of HA and NA genes of A/Anhui/1/2013(H7N9) (GISAID accession: EPI_ISL_138739) except the probe H7-P-M, which is based on the HA gene of A/Guangdong/Th005/2017(H7N9) (GISAID accession: EPI_ISL_250424)