Skip to main content

Table 2 Primer Sequence for nested PCR amplification

From: Coinfections identified from metagenomic analysis of cervical lymph nodes from tularemia patients

Pathogen Target Nested PCR scheme Primer Sequence Amplicon size Sanger Sequence target Gene Target Published
Hepatitis B_F1 Outer Forward GGGAGGAGATTAGGTTAA 216 bp NA DistalX/pre-C gene Chakravarty et al., 2002
Hepatitis B_R1 Outer Reverse GGCAAAAAAGAGAGTAACTC
Hepatitis B_F1 Internal Forward *agctttccttgtttcgaattttataaTCTGTTCACCAGCACCAT 74 bp 37 bases
Hepatitis B_R1 Internal Reverse AGGCTTGAACAGTAGGACA
HpB19_F1 Outer Forward CAAAAGCATGTGGAGTGAGG 398 bp NA VP1 Koch and Adler et al., 1990
HpB19_R1 Outer Reverse CTACTAACATGCATAGGCGC
HpB19_F1 Internal Forward CCCAGAGCACCATTATAAGG 288 bp 251 bases Yamakawa et al., 1995
HpB19_R1 Internal Reverse GTGCTGTCAGTAACCTG