Skip to main content

Table 1 Primers and probes used to detect arbovirus and hepatitis E virus

From: Identification of pathogens for differential diagnosis of fever with jaundice in the Central African Republic: a retrospective assessment, 2008–2010

Primers and probes Nucleic acid sequences of primers and probes
qPCR Zika virus (ZIKV)
 ZIKV forward 5-nt9271AARTACACATACCARAACAAAgTggT9297–3’
 ZIKV reverse 5′ nt9352-TCCRCTCCCYCTYTggTCTTg-9373 -3’
 ZIKV probe nt 9304-FAM-CTYAgACCAgCTgAAR-BBQ-9320
qPCR Dengue total (DENV 1–4 system)
 DENT forward 5′- AGGACYAGAGGTTAGAGGAGA - 3’
 DENT reverse 5′- CGYTCTGTGCCTGGAWTGAT −3’
 DENT probe FAM-ACAGCATATTGACGCTGGGARAGACC-TAMRA
qPCR Dengue subtypes (DENV1, DENV2, DENV3)
 DEN1 forward 5′ ATACCYCCAACAGCAGGAATT - 3’
 DEN1 reverse 5′ AGCATRAGGAGCATGGTCAC −3’
 DEN1 probe FAM-TTGGCTAGATGGRGCTCATTCAAGAAGAAT-TAMRA
 DEN2 forward 5′ TGGACCGACAAAGACAGATTCTT 3’
 DEN2 reverse 5′ CGYCCYTGCAGCATTCCAA 3’
 DEN2 probe FAM-CGCGAGAGAAACCGCGTGTCRACTGT-TAMRA
 DEN3 forward 5′ AAGACGGGAAAACCGTCTATCAA 3’
 DEN3 reverse 5′ TTGAGAATCTCTTCGCCAACTG 3’
 DEN3 probe FAM-ATGCTGAAACGCGTGAGAAACCGTGT-TAMRA
qPCR Chikungunya (CHIK)
 CHIK forward 5′- AAGCTYCGCGTCCTTTACCAAG - 3’
 CHIK reverse 5′- CCAAATTGTCCYGGTCTTCCT −3’
 CHIK probe FAM-CCAATGTCYTCMGCCTGGACACCTTT-TAMRA
qPCR Rift Valley fever virus (RVFV)
 RVFV forward 5′- AAA ggA ACA ATg gAC TCT ggT CA - 3’
 RVFV reverse 5′- CAC TTC TTA CTA CCA TTC CTC CAA T − 3’
 RVFV probe FAM-AAA gCT TTg ATA TCT CTC AgT gCC CCA A -TAMRA
qPCR West Nile virus (WNV)
 WNV3p forward 5′ Agg TTA gWg gAg ACC CCg T - 3’
 WNV3p reverse 5′ ggT TgT gCA gAg CAg AAg ATC −3’
 WNV3p probe FAM-CGGTTCCGGCGGTGGTTTCT-TAMRA
Conventional PCR Crimean-Congo haemorrhagic fever virus (CCHFV)
 CCHFV forward 5′ – TGGACACCTTCACAAACTC - 3’
 CCHFV reverse 5′ – GACAAATTCCCTGCACCA - 3’
qPCR Hepatitis E virus (HEV)
 HEV forward 5′ GCCCGGTCAGCCGTCTGG −3’
 HEV reverse 5′-CTGAGAATCAACCCGGTCAC −3’
 HEV probe FAM-CGGTTCCGGCGGTGGTTTCT-TAMRA