Skip to main content

Table 1 Primers used for SNPs of FoxP3 gene

From: G allele at −924 A > G position of FoxP3 gene promoter as a risk factor for tuberculosis

Position Method Primer Sequences Allele Phenotypes
−3279 A > C (rs3761548)   Forward: CTGGCTCTCTCCCCAACTGA
Forward: TGGCTCTCTCCCCAACTGC
Common Reverse: ACAGAGCCCATCATCAGACTCTCTA
A: 334 bp
C: 333 bp
−924 A > G (rs2232365) PCR-SSP Forward: CCCAGCTCAAGAGACCCCA
Reverse: GGGCTAGTGAGGAGGCTATTGTAAC
Forward: CCAGCTCAAGAGACCCCG
Reverse: GCTATTGTAACAGTCCTGGCAAGTG
A: 442 bp
G: 427 bp
FoxP3 gene qRT- PCR Forward: CAGCTGCCCACACTGCCCCTAG
Reverse: CATTTGCCAGCAGTGGGTAG
 
GAPDH gene Forward: CCAGGTGGTCTCCTCTGACTTCAACA
Reverse: AGGGTCTCTCTCTTCCTCTTGTGCTCT