Skip to main content

Table 1 MLVA loci and PCR primer sequences

From: Investigation of Salmonella Enteritidis outbreaks in South Africa using multi-locus variable-number tandem-repeats analysis, 2013-2015

Target gene locus PCR primer Primer sequence (5′ to 3′) Expected fragment sizes (bp) VNTR repeat length (bp) VNTR references
SENTR7 SENTR7-F 6FAM-ACGATCACCACGGTCACTTC 117–135 9 [15]
SENTR7-R CGGATAACAACAGGACGCTTC
SENTR5 SENTR5-F 6FAM-CACCGCACAATCAGTGGAAC 235–301 6 [15]
SENTR5-R GCGTTGAATATCGGCAGCATG
SENTR6 SENTR6-F NED-ATGGACGGAGGCGATAGAC 173–236 7 [15]
SENTR6-R AGCTTCACAATTTGCGTATTCG
SENTR4 SENTR4-F VIC-GACCAACACTCTATGAACCAATG 112–147 7 [15]
SENTR4-R ACCAGGCAACTATTCGCTATC
SE-3 SE-3-F VIC-CAACAAAACAACAGCAGCAT 308–320 12 [15]
SE-3-R GGGAAACGGTAATCAGAAAGT