Skip to main content

Table 1 Details of vectors, gene primers and host cells used in this study

From: Evaluation of recombinant porin (rOmp2a) protein as a potential antigen candidate for serodiagnosis of Human Brucellosis

S.No. Components used Name/Sequence Source
1 Vector pET-SUMO Invitrogen
2 Host cells Mach1™-T1R Chemically competent E. coli cells
BL21(DE3) chemically competent E. coli. Cells
Invitrogen
Sigma
3 Gene omp2a B. melitensis 16 M genome
4 Primer used for omp2a gene amplification Forward - 5’ATGAACATCAAGAGCCTT3’
Reverse - 5’TTAGAACGAGCGCTG3’
This study
5 T7-promoter reverse sequencing primer of vector Reverse - 5’TAGTTATTGCTCAGCGGTGG3’ Invitrogen