Skip to main content

Advertisement

Table 2 Primers for the ZIKV RNA ChIP assays

From: Determination of the Cell Permissiveness Spectrum, Mode of RNA Replication, and RNA-Protein Interaction of Zika Virus

Sequence Start nt End nt
Forward AGTTGTTGATCTGTGTGAGTCAG 1 23
Reverse GCATATTGACAATCCGGAATCCT 133 156
Forward GATTCCGGATTGTCAATATGCTAAA 135 160
Reverse GTGATGGCTTGATTGCTGTAAA 272 294
Forward AGCCATCACTGGGCCTT 285 302
Reverse TAGTCAGCAGGAGGCCAAT 443 462
Forward TCCTGCTGACTACAGCCAT 450 469
Reverse TGCCCGAGGTCCATGAT 584 601
Forward CAAGTGCCACGTACAGATCAT 568 589
Reverse TAGATCGCCGTGCCTCA 730 747
Forward GCACGGCGATCTAGAAGAG 734 753
Reverse AATGGCAACGGCCACTA 882 899
Forward TAGTGGCCGTTGCCATTG 882 900
Reverse AAGACAACATCAACCCAGGTC 1030 1051
Forward TGGGTACCAACTGGGAGAA 10,031 10,050
Reverse TCCTAGATAGGGAATGTCTGTCC 10,170 10,193
Forward AAATGGACAGACATTCCCTATCT 10,166 10,189
Reverse TAGCGGACTTGGGTGGATA 10,323 10,342
Forward TATCCACCCAAGTCCGCTAC 10,323 10,343
Reverse CGTTCTCGGCCTGACTATGA 10,475 10,495
Forward CTCATAGTCAGGCCGAGAAC 10,474 10,494
Reverse CACAGCTAGTCTCCAGTTCAG 10,623 10,644
Forward GAACTGGAGACTAGCTGTGAAT 10,625 10,646
Reverse GCTGTTCGGCGATCTGT 10,760 10,776
  1. Based on the nt sequence of MR766