Skip to main content

Table 2 Primers for DENV and CHIKV amplification and sequencing

From: Imported arboviral infections in Italy, July 2014-October 2015: a National Reference Laboratory report

Primers Sequence (5’- 3’) Reference
RT-PCR: [35]
 DEUL TGGCTGGTGCACAGACAATGGTT
 DEUR GCTGTGTCACCCAGAATGGCCAT
Nested PCR:
 DENUL GATCTCAAGAAGGAGCCATGCA
 DENUR ATGGAACTTCCCTTCTTGAACCA
RT-PCR: [36]
 CHIK 10264 F GGCGCCTACTGCTTCTG
 CHIK 11300R CGACACGCATAGCACCSC
Nested PCR:
 CHIK 10564 F CCCTTTGGCGCAGGAAGAC
 CHIK 11081R GACTTGTACGCGGAATTCGG