Skip to main content

Table 1 Primers and probes for the molecular diagnosis

From: Imported arboviral infections in Italy, July 2014-October 2015: a National Reference Laboratory report

Primers and Probes Sequence (5’- 3’) Reference
DenS GGATAGACCAGAGATCCTGCTGT [33]
DenAs + DenAs1 CATTCCATTTTCTGGCGTTC + CAATCCATCTTGCGGCGCTC
DenP FAM-CAGCATCATTCCAGGCACAG-TAMRA
ChikS TGATCCCGACTCAACCATCCT [11]
ChikAs GGCAAACGCAGTGGTACTTCCT
ChikP FAM-TCCGACATCATCCTCCTTGCTGGC-Black Hole Quencher 1
Zvf1086 CCGCTGCCCAACACAAG [34]
Zvr1162c CCACTAACGTTCTTTTGCAGACAT
ZvP_1107 6FAM-AGCCTACCTTGACAAGCAGTCAGACACTCAA-TAMRA