Skip to main content

Table 3 Primers for Pol and LTR amplification and sequencing

From: The PTAP sequence duplication in HIV-1 subtype C Gag p6 in drug-naive subjects of India and South Africa

Amplification primers
Primer Number Description Co-ordinates (HXB2) /Length Sequence (5'–3') Product length
Protease
 N1636 EFP 1978–2006, 29 AAGGAAGGGCACCCAGCCAGAAATTGCAG 864
 N1637 ERP 2813–2842, 30 GCGGGATGTGGTATCCCTAATTGAACTTCC
 N1638 IFP 2075–2103, 29 GACAGGCTAATTTTTTAGGGAARATTTGG 530
 N1639 IRP 2577–2605, 29 GGGCCATCCATTCCTGGCTTTAATTTTAC
RT
 N1641 EFP 2368–2395, 28 CAGGAAGATGGAAACCAAAAATGATAGG 2114
 N1642 ERP 4455–4482, 28 CTATATATCCACTGGCTACATGAACTGC
 N1643 IFP 2489–2509, 21 TACACCTGTCAACATAATTGG 1816
 N1644 IRP 4285–4305, 21 AATCACTAGCCATTGCTCTCC
RNaseH/Integrase
 N2244 EFP 3628–3660, 33 CCCACACTAATGATGTAAAACAGTTAACAGAGG 1659
 N2245 ERP 5257–5287, 31 CCATGACCCAAATGCCAATCTCTTTCTCCTG
 N2246 IFP 3738–3765, 28 ATGGGAAACATGGTGGACAGACTATTGG 1476
 N2247 IRP 5185–5214, 30 TGGGATGTGTACTTCTGAACTTAYTTTTGG
LTR
 N698 EFP 1–34, 34 TGGAAGGGTTAATTTACTCYMAGAAAAGRCAAGA 555
 N1032 ERP 538–556, 19 TAGAGCACGCAAGGCAAGC
 N558 IFP 1–43, 43 TGGAAGGGTTAATTTACTCTAAGGAAAGGCAAGAGATCCTTG 431
 N1204 IRP 411–432, 21 CTTATATGCAGGATCTGAGGG
Sequencing primers gene
 N1645 Forward Primers 2620–2635, 16 GGCCATTGACAGAAGA RT
 N1646 3108–3124, 17 TTGTATGTAGGATCTGA
 N1647 3626–3642, 17 TGCCCACACTAATGATG
 N1648 Reverse primers 3870–3886, 17 GCTGCCCCATCTACATA
 N1649 3345–3362, 18 GTAAATCTGACTTGCCCA
 N1650 2889–2906, 18 GGGAACTGAAAAATATGC
 9 M Forward Primers 4145–4167, 21 CCTGTCATGGGTACCAGCACA RNaseH/Integrase
 10 M 4664–4687, 24 CCAAAGTCAGGGAGTAGTAGAATC
 28 M Reverse primers 4957–4978, 22 ACTACTGCCCCTTCACCTTTCC
 29 M 4380–4401, 22 GACTGCAGTCTACTTGTCCATG
  1. Protease and LTR were sequenced using amplification primers