Skip to main content

Table 2 Primers for Gag amplification and sequencing

From: The PTAP sequence duplication in HIV-1 subtype C Gag p6 in drug-naive subjects of India and South Africa

Amplification primers
Primer Number Description Co-ordinates (HXB2) /Length Sequence (5'–3') Product length
Set I
 N420 EFP 683–709, 27 CTCTCGACGCAGGACTCGGCTTGCTGA 1712
 N1476 ERP 2366–2395, 29 CTATCATTTTTGGTTTCCATYTTCCTGGC
 N1356 IFP 790–806, 27 AAGGAGACATATGGGTGCGAGAGCGTC 1516
 N1435 IRP 2274–2306, 30 ATTTGGCCCCCTCGAGTTGAGACAAGRGGTCG
Set II
 N420 EFP 683–709, 27 CTCTCGACGCAGGACTCGGCTTGCTGA 1832
 N1634 ERP 2484–2515, 32 TTTCTTCCAATTATGTTGAYAGGTGTRGGTCC
 N1632 IFP 777–806, 30 TAGAAGGCTCGAGATGGGTGCGAGAGCGTC 1666
 N1633 IRP 2413–2443, 32 ATRRGTATTTGATCATAYTGTCTTACTTTGAT
Set III
 N1788 EFP 577–604, 29 GACTCTGGTAACTAGAGATCCCTCAGAC 2315
 N1789 ERP 2862–2892, 35 ATGCATCA/CCCCACATCCAGTACTGTYACTG
 N1786 IFP 625–647, 28 ATCTCTAGCAGTGGCGCCCGAACAGGGAC 2211
 N1787 IRP 2801–2836, 30 TGTGGAATTCCTAATTGRACYTCCCARAATCTG
Set IV- p6 Gag
 N2301 EFP 1752–1778, 27 GTTGGTCCAAAATGCGAACCCAGATTG 1090
 N2302 ERP 2813–2842, 29 GGGCCATCCATTCCTGGCTTTAATTTTAC
 N2304 IFP 1859–1885, 27 GCCACAAAGCAAGAGTGTTGGCTGAGG 549
 N2305 IRP 2382–2408, 27 ACCTCCAATTCCTCCTATCATTTTTGG
Sequencing primers
 N1619 Forward Primers 1040–1056, 17 GGCCATTGACAGAAGA  
 N1620 1609–1626, 18 TTGTATGTAGGATCTGA  
 N1621 2092–2107, 16 TGCCCACACTAATGATG  
 N1812 2035–2058, 25 TGTGGAAAGGAAGGACACCAAATG  
 N1489 1302–1326, 25 TGTTTACAGCATTATCAGAAGGAGC  
 N1622 Reverse primers 1835–1818, 18 GCTGTCATCATYTCTTCT  
 N1623 1329–1313, 17 GGTGGCTCCTTCTGATA  
 N1624 910–895, 16 GCTCCCTGCTTGCCCA  
 N1490 1826–1849, 24 CACTCCCTGACATGCTGTCATCAT  
  1. EFP- External forward primer, ERP-External reverse primer, IRP- Internal reverse primer, IFP-Internal forward primer, Reverse primers have been presented as reverse complement