Skip to main content

Table 1 RPA primers and probe designed in this study

From: Field evaluation of a recombinase polymerase amplification assay for the diagnosis of Schistosoma japonicum infection in Hunan province of China

Name Sequence
S. japonicum RPA FP CCAAGTCTCAGTGAAGTTGTGAAGGCTAT
S. japonicum RPA RP GTTAGTGTTCGAGACCAGTCAGATGGGATT
S. japonicum RPA P CTTAAAGCGAGGGAGAGCGGCAGGACCAGA
(dT-FAM)G(THF)A(dT-BHQ1)TGACCCCTGAGATAT[3’-block]
  1. FP forward primer, RP reverse primers, P probe, dT-FAM thymidine nucleotide carrying fluorescein, THF tetrahydrofuran spacer, dT-BHQ1 thymidine nucleotide carrying black hole quencher