Skip to main content

Table 1 Primers used in this study

From: Molecular epidemiology of bla OXA-23 -producing carbapenem-resistant Acinetobacter baumannii in a single institution over a 65-month period in north China

Primer Sequence(5′ to 3′) Target Reference
MOXMF GCTGCTCAAGGAGCACAGGAT MOX-1, MOX-2, CMY-1,
CMY-8 to CMY-11;
[25]
MOXMR CACATTGACATAGGTGTGGTGC  
CITMF TGGCCAGAACTGACAGGCAAA LAT-1 to LAT-4, CMY-2
to CMY-7, BIL-1;
[25]
CITMR TTTCTCCTGAACGTGGCTGGC  
DHAMF AACTTTCACAGGTGTGCTGGGT DHA-1, DHA-2 [25]
DHAMR CCGTACGCATACTGGCTTTGC  
ACCMF AACAGCCTCAGCAGCCGGTTA ACC [25]
ACCMR TTCGCCGCAATCATCCCTAGC  
EBCMF TCGGTAAAGCCGATGTTGCGG MIR-1 T ACT-1 [25]
EBCMR CTTCCACTGCGGCTGCCAGTT  
FOXMF AACATGGGGTATCAGGGAGATG FOX-1 to FOX-5b [25]
FOXMR CAAAGCGCGTAACCGGATTGG  
AmpCF ACAGAGGAGCTAATCATGCG AmpC [26]
AmpCR GTTCTTTTAAACCATATACC   
OXA-23-likeF GATCGGATTGGAGAACCAGA' blaOXA-23-like [27]
OXA-23-likeR ATTTCTGACCGCATTTCCAT   
OXA-40-likeF GGTTAGTTGGCCCCCTTAAA blaOXA-40-like [27]
OXA-40-likeR AGTTGAGCGAAAAGGGGATT   
OXA-51-likeF TAATGCTTTGATCGGCCTTG blaOXA-51-like [27]
OXA-51-likeR TGGATTGCACTTCATCTTGG   
OXA-58-likeF AAGTATTGGGGCTTGTGCTG blaOXA-58-like [27]
OXA-58-likeR CCCCTCTGCGCTCTACATAC   
OXA-143 TGGCACTTTCAGCAGTTCCT blaOXA-143 [28]
OXA-143 TAATCTTGAGGGGGCCAACC