Skip to main content

Advertisement

Table 1 Nucleotide sequences of the SS-LAMP primers targeting the IS6110 sequence of MTBC strains

From: Development and evaluation of an in-house single step loop-mediated isothermal amplification (SS-LAMP) assay for the detection of Mycobacterium tuberculosis complex in sputum samples from Moroccan patients

Primer type Positions Sequence 5’-3’
FIP(F1c-F2) 835-853/786-803 ACGTAGGCGAACCCTGCCCCCAGCACCTAACCGGCTG
BIP(B1c-B2) 861-879/922-939 GTCACCGACGCCTACGCTCTCGCGTCGAGGACCATGG
F3 (FOP) 761-778 TCTCGTCCAGCGCCGCTT
B3 (BOP) 945-962 GCGGGTCCAGATGGCTTG
FLP 813-831 TCGACACATAGGTGAGGTC
BLP 901-918 TCGCTTCCACGATGGCCA