Skip to main content

Table 3 Probe sequences for EMSA

From: PU.1 is involved in the immune response to Aspergillus fumigatus through upregulating Dectin-1 expression

Probes Sequence (5′–3′) Biotin Genes
Positive control PU.1-TP CTGCCTCCTACTTCTCCTTTTCTGC
PU.1-BM GCAGAAAAGGAGAAGTAGGTGGCAG
+ CD11b
Probe A probe1-TP TTACTTTTGGGGAAGTTGAGTTCAG probe1-BM CTGAACTCAACTTCCCCAAAAGTAA + Dectin-1
Probe B probe1-BM CTGAACTCAACTTCCCCAAAAGTAA probe2-TP TGATGAAAGAGGCAGTGTAGCGTAA + Dectin-1
Probe C probe3-TP GATTGAACAAGAAAATATGTACAAC probe3-BM GTTGTACATATTTTCTTGTTCAATC + Dectin-1
Competitor Paired with each biotin-labeled probe -