Skip to main content

Table 1 Primer sequences for real-time PCR

From: PU.1 is involved in the immune response to Aspergillus fumigatus through upregulating Dectin-1 expression

Primers Sequence (5′–3′)
hDectin-1-Forward GCAATACCAGGATAGCTGTTG
hDectin-1-Reverse CCAAGCATAGGATTCCCAA
hPU.1- Forward CGTGCACAGCGAGTTCGA
hPU.1-Reverse GCTCTGGAGCTCCGTGAAGT
GAPDH- Forward ACAGTCAGCCGCATCTTCTT
GAPDH-Reverse ACGACCAAATCCGTTGACTC