Skip to main content

Advertisement

Table 1 Primers and Probe sequences used in detection of dengue and chikungunya

From: Prevalence of dengue and chikungunya virus infections in north-eastern Tanzania: a cross sectional study among participants presenting with malaria-like symptoms

Sequence name Primer sequence (5′–3′) Region, position Digital object identifier (DOI)
DENV-R GHRGAGACAGCAGGATCTCTG 3′UTR, 10674–10694 10.1016/S1995–7645(12)60055–8
DENV-F GACTAGYGGTTAGAGGAGACC 3′UTR, 10520–10541
DENV-P Cy5-AAGGACTAGMGGTTAGWGGAGACCC-BHQ2 3′UTR, 10610–10634  
CHIKV-F CGTGGTGTACAAAGGTGACG E1, 10524  
CHIKV-R ACG CCG GGTAGTTGACTATG E1, 11170 10.1002/jmv.23406