Skip to main content

Advertisement

Table 1 Primers used for the MLST-7 scheme for Chlamydia trachomatisa

From: Does typing of Chlamydia trachomatis using housekeeping multilocus sequence typing reveal different sexual networks among heterosexuals and men who have sex with men?

Region Locus tagb Format Direction Sequence (5′ to 3′) 5′ positionc Fragment length (bp)d
gatA CT0003 Outer Forward GCTTTAGAATTARSARAWGCT 2123 325
   Outer Reverse GATCCTCCGGTATCYGATCC 2615  
   Inner + Seq Forward ATGACGAACAGATTGGAGC 2186  
   Inner + Seq Reverse GGATTATTGGTAGGATGAA 2532  
oppA_3 CT0198 Outer Forward ATGCGCAAGATATCAGTGGG 222438 480
   Outer Reverse AAAGCTCCRSTWGMTATMGGWAG 223002  
   Inner + Seq Forward TCCTAGCATTAGCAACTTCT 222469  
   Inner + Seq Reverse TCTTTCCGTATCTGATGCTGCG 222970  
hflX CT0379 Outer Forward GCTTCTARAGTACTTTTAAATG 432737 359
   Outer Reverse TATTTRGAAATYTTTKCSAGYCG 432758  
   Inner + Seq Forward AAGTATGCGGAAGTTTGCG 432768  
   Inner + Seq Reverse AATCAGGAGGTAGTGGTGGAGG 433106  
gidA CT0498 Outer Forward GGAGTCWCTACWAAAGAAGG 577352 389
   Outer Reverse TCGTAYTGYACATCRAAAGG 577892  
   Inner + Seq Forward ACTTCTCTGGGGGACGATT 577449  
   Inner + Seq Reverse GACCGTTCACATAAACTTCTTG 577856  
enoA CT0587 Outer Forward GCAAATACTTTACAGAGACCTT 662222 388
   Outer Reverse CGTCACAAATAGGTCGTCTC 662775  
   Inner + Seq Forward CCTATGATGAATCTKATCAATGG 662288  
   Inner + Seq Reverse TCTTCTTCGGCTAGCCCATCT 662698  
hemN CT0746 Outer Forward GAATCTTGCCTTTCACAGTTGC 867674 448
   Outer Reverse ACTTCCACATCCCATTCTGC 868584  
   Inner + Seq Forward AGATCTTCTTCWGGRGGWAGAGA 867799  
   Inner + Seq Reverse TTCYTTCAKAACSTAGGTTTT 868269  
fumC CT0855 Outer Forward ATTAAAAAATGTGCTGCT 1004691 451
   Outer Reverse CCTTCAGGAACATTYAACCC 1005242  
   Inner + Seq Forward ATTAAAAAATGTGCTGCT 1004691  
   Inner + Seq Reverse CCGCTCTAAACAATTATGCAACTG 1005159  
  1. aThe primers given in boldface were the original MLST primers taken from Pannekoek et al. [9]. All other primers were newly designed. Nested PCRs were performed for each region. The primers used for the outer PCRs are indicated with Outer, those used for the inner PCRs are indicated with Inner, and those used for sequencing are indicated with Seq
  2. bLocus tags are given relative to the sequence of reference strain D/UW-3/CX (GenBank accession no. AE001273)
  3. cPositions are given in base pairs relative to the sequence of reference strain D/UW-3/CX (GenBank accession no. AE001273)
  4. dFragment length is the number of base pairs sequenced with the primers excluded