Skip to main content

Table 1 Primers used for amplification of HAV and HBV

From: Hepatitis B infection is highly prevalent among patients presenting with jaundice in Kenya

Virus to be amplified Primer Name Sequence (5′–3′)
HAVa HAV F1 GACAGATTCTACATTTGGATTGGT
HAV R1 CCATTTCAAGAGTCCACACACT
nested HAV F2 CTATTCAGATTGCAAATTACAAT
nested HAV R2 AACTTCATTATTTCATGCTCCT
HBVb S1f TCCTGCTGGTGGCTCCAG
S1r CGTTGACATACTTTCCAATCAA
nested S2f ACCCTGYRCCGAACATGGA
nested S2r CAACTCCCAATTACATARCCCA
C1 (EP1) GCATGGAGACCACCGTGAAC
C1 (EP2) GGAAAGAAGTCAGAAGGCAA
nested C2 (EP3) CATAAGAGGACTCTTGGACT
nested C2 (EP4) GGCAAAAAAGAGAGTAACTC
  1. a[20]; b[53, 54]