Skip to main content

Table 1 Polymerase chain reaction primers for diarrhoeagenic genes, IS3 and fliC of Escherichia coli a

From: Diarrhoeagenic Escherichia coli in mother-child Pairs in Ile-Ife, South Western Nigeria

Target gene or probe Type Primer Designation Primers (5’ to 3’) Amplicon size (base pair)
eae EPEC/EHEC eae 1 CTGAACGGCGATTACGCGAA 917
   eae 2 CCAGACGATACGATCCAG  
bfp EPEC bfp 1 AATGGGCTTGCGCTTCCAG 326
   bfp 2 GCCGCTTTATCCAACCTGGTA  
CVD432 EAEC EAEC1 CTGGCGAAAGACTGTATCAT 630
   EAEC2 CAATGTATAGAAATCCGCTGTT  
LT gene ETEC LTf GGCGACAGATTATACCGTGC 450
   LTr CGGTCTCTATTATACCGTGC  
ST gene ETEC STf ATTTTTMTTTCTGTATTRTCTT 190
   STr CACCCGGTACARGCAGGATT  
ipaH EIEC IpaH1 GTTCCTTGACCGCCTTTCCGATACCGTC 600
   IpaH2 GCCGGTCAGCCACCCTCTGAGAGTAC  
Stx1 EHEC/STEC Stx1f ATAAATCGCCATTCGTTGACTAC 180
   Stx2r AGAACGCCCACTGAGATCATCC  
stx2 EHEC/STEC Stx2f GGCACTGTCTGAAACTGCTCC 255
   Stx2r TCGCCAGTTATCTGACATTCTG  
IS3 N/A IS3 ACACTTAGCCGCGTGTCC Variable
fliC N/A F-FLIC1 ATGGCACAAGTCATTAATACCCAAC Variable
   R-FLIC2 CTAACCCTGCAGCAGAGACA  
  1. a eae intimin, EPEC Enteropathogenic E. coli, EHEC Enterohemorrhagic E. coli, bfp bundle forming pilus, CVD432 aggregative adherence plasmid marker, EAEC Enteroaggregative E. coli, LT Heat-labile toxin, ETEC Enterotoxigenic E. coli, ST Heat-stable toxin, ipaH invasive plasmid antigen, EIEC Enteroinvasive E. coli, stx shiga toxin, STEC shiga toxin producing E. coli, N/A Not applicable