Skip to main content

Table 2 Nucleic Acid sequences of primers and probes

From: Development of a rapid recombinase polymerase amplification assay for the detection of Streptococcus pneumoniae in whole blood

Probe/primer DNA sequence (5’-3’) Nucleotide positiona Amplicon size (bp)
RPA    190
Forward ACAGCTCCGTCTGTTATTTACAAAGTTAATTTGA*C 1123–1157  
Reverse AGTCCCCACGCTTACGCTGAGCTAGCTCCATTAC*T 1278–1312  
Probe CTTGACATAAGGCTCTTCAATGGTCGCAATCT[T(FAM)]A(dSpacer)[T(BHQ-1)]TGGGTCTGGAAAC*T 1193–1242  
PCR    107
Forward CTCGTAAGCGTAAACTCCTTG 1706–1727  
Reverse CATACTCAAGACGCTGAGGA 1793–1813  
Probe FAM-ACGCATGAAATCCATCGGATCAGTT-TAMRA 1749–1773  
  1. aThe nucleotide position refers to the LepA gene from S. pneumoniae strain SPNA45 (Genbank accession number NC_018594.1)
  2. *indicates a phosphorothioate bond