Skip to main content

Table 1 Primers used for the detection of TEM-1 and tetM in N. gonorrhoeae

From: The prevalence and epidemiology of plasmid-mediated penicillin and tetracycline resistance among Neisseria gonorrhoeae isolates in Guangzhou, China, 2002–2012

Gene Primer Direction Primer sequencea (5′-3′) Reference
TEM-1 BL1 Forward 1545TACTCAATCGGTAATTGGCT1564 Palmer HM et al.24,a
BL2 Forward 3606CACCTATAAATCTCGCAAGC3625
BL3 Reverse 4564CCATAGTGTTGAGTATTGCGAA4543
BL4 Reverse 6528TCATTCGTGCGTTCTAGGA6510
tetM UF Forward 825CTCGAACAAGAGGAAAGC842 Turner A et al.25
AR Reverse 1602GCATTCCACTTCCCAAC1586
DR Reverse 1267TGCAGCAGAGGGAGG1253
  1. aPositions are based on the Asian plasmid, Genbank accession number U20374