Skip to main content

Advertisement

Table 1 Primers used for PCR and sequencing

From: Molecular characterisation of hepatitis B virus in HIV-1 subtype C infected patients in Botswana

Primer Name Sequence 5′-3′ Position
P1 CCGGAAAGCTTGAGCTCTTCTTTTTCACCTCTGCCTAATCA 1821–1841
P2 CCGGAAAGCTTGAGCTCTTCAAAAAGTTGCATGGTGCTGG- 1823–1806
Werle AS CGTCAGCAAACACTTGGC 1175–1192
Core F GTGTGGATTCGCACTCCT 2269–2287
HBV-3 CGTTGCCKDGCAACSGGGTAAAGG 2478–2455
HBV-N ACTGAGCCAGGAGAAACGGACTGAG GC 1991–1965
HBV-P TCATCCTCAGGCCATGCAGT 1292–1311
HBV-Z AGCCCTCAG GCTCAGGGCATA 1179–1199
HBV-H TATCAAGGAATTCTGCCCGTTTGTCCT 1767–1793
P6 GGCAGGTCCCCTAGAAGAAGAACT 2363–2386