Skip to main content

Table 2 Sequences of the primers used to amplify the msp1 gene of P. falciparum isolates along the slope of Mount Cameroon

From: Plasmodium falciparum merozoite surface protein 1 block 2 gene polymorphism in field isolates along the slope of mount Cameroon: a cross – sectional study

Amplification Allele Primer Primer sequence
Primary PCR    
NA Forward 5I - CTAGAAGCTTTAGAAGATGCAGTATTG - 3I
Reverse 3I - CTTAAATAGTATTCTAATTCAAGTGGATCA - 5I
Secondary PCR    
K1 Forward 5I - AAATGAAGAAGAAATTACTACAAAAGGTGC - 3I
Reverse 3I - GCTTGCATCAGCTGGAGGGCTTGCACCAGA - 5I
MAD20 Forward 5I - AAATGAAGGAACAAGTGGAACAGCTGTTAC - 3I
Reverse 3I - ATCTGAAGGATTTGTACGTCTTGAATTACC - 5I
RO33 Forward 5I - TAAAGGATGGAGCAAATACTCAAGTTGTTG - 3I
Reverse 3I - CATCTGAAGGATTTGCAGCACCTGGAGATC - 5I
MR Forward 5I - AAATGAAGGAACAAGTGGAACAGCTGTTAC - 3I
Reverse 3I - CATCTGAAGGATTTGCAGCACCTGGAGATC - 5I
  1. NA Not Applicable