From: Antibacterial properties of Acinetobacter baumanniiphage Abp1 endolysin (PlyAB1)
Name | Characteristics / function | Source |
---|---|---|
P1 | GGATCCATGATTCTGACTAAAGACGGGTT | Beijing Genomics Institution |
P2 | CTCGAGCTATAAGCTCCGTAGAGCGC | Beijing Genomics Institution |
OXA-51-F | TAATGCTTTGATCGGCCTTG | Beijing Genomics Institution |
OXA-51-R | TGGATTGCACTTCATCTTGG | Beijing Genomics Institution |
BL21(DE3) | Expression host for recombinant plasmid | Purchased from Sangon Biotech |
pET28a | Expression vector (kanamycin resistant) | Our laboratory collection |
pET28a-plyAB1 | Recombinant vector (kanamycin resistant) | This study |
Abp1 | Phage of AB1. Isolated from hospital sewage | Our laboratory collection |
AB001-AB040 | XDRAB. Isolated from the Southwest Hospital of Chongqing. China | Our laboratory collection |
JM109 | E. coli strain for testing host range | Our laboratory collection |
BL21 | E. coli strain for testing host range | Our laboratory collection |
N315 | S. aureus strain for testing host range | Our laboratory collection |
PAO1 | P. aeruginosa strain for testing host range | Our laboratory collection |