Skip to main content

Advertisement

Table 1 Primers and probes used to detect SNPs

From: Obesity-associated gene FTO rs9939609 polymorphism in relation to the risk of tuberculosis

SNPs   Sequence (5'-3') Detecting allele
rs9939609 F CTAACATCAGTTATGCATTTAGAATGTCTG  
R CCCACTCCATTTCTGACTGTTACC  
Probe-T FAM-CTGTGAATTTTGTGATGC-MGB Allele T
Probe-A HEX-CTGTGAATTTAGTGATGCA-MGB Allele A
rs8050136 F CAGTGCCAGCTTCATAGCCTAGT  
R CCATGAGTCCATCTCTACAGTTTACC  
Probe-C HEX-CTGTGGCAATCAATAT-MGB Allele C
  Probe-A FAM-CTGTGGCAATAAATA-MGB Allele A