Skip to main content

Advertisement

Table 1 PCR primers used for amplification

From: Keratitis by Fusarium temperatum, a novel opportunist

Locus Primers primer sequence (5’-3’) Amplicon size, bp Ref
TEF1α EF1 ATGGGTAAGGARGACAAGAC 600 [17]
EF2 GG ARGTACCAGTSATCATGTT   [17]
BT2 BT-2a GGTAACCAAATCGGTGCTGCTT 500 [18]
BT-2b TTACGTCCCTGCCCTTTGTA   [19]