Skip to main content

Table 2 Oligonucleotides and PCR primers used in this study (complementary sequences are underlined).

From: PCR melting profile (PCR MP) - a new tool for differentiation of Candida albicansstrains

PCR MP Restriction ligated oligonucleotide (POW) 5' CTCACTCTCACCAACAACGTCGAC 3'
  enzyme helper oligonucleotide (HinHELP) 5' AGCTGTCGACGTTGG 3'
  HindIII primer (POW-AGCTT) 5' CTCACTCTCACCAACGTCGACAGCTT 3'
RAPD Primer 1247 5' AAGAGCCCGT 3'
   1290 5' GTGGATGCGA 3'