Skip to main content

Table 1 Primer sequence used for real time RT-PCR

From: HIV-1 Tat protein alter the tight junction integrity and function of retinal pigment epithelium: an in vitro study

Gene Accession number upper lower
Occludin NM_002538 5' CATTGCCATCTTTGCCTGTG3' 5' AGCCATAACCATAGCCATAGC3'
Claudin1 NM_021101 5' CAGGCTACGACCGCAAC3' 5' CAGGCTACGCAAGGAC3'
Claudin2 NM_020384 5' CCCAAACCCACTAATCACATC3' 5' GCCACTGCTTCTCCTTCC3'
Claudin3 NM_001306 5' CAGGCTACGACCGCAAGGAC3' 5' GGTGGTGGTGGTGGTGTTGG3'
Claudin4 NM_001305 5' GGCGTGGTGTTCCTGTTG3' 5' AGCGGATTGTAGAAGTCTTGG3'
Claudin5 NM_003277 5' TACCGCAGGAAGAGGAGCAG3' 5' GCCCGAAGCAGCCAATCC3'
GAPDH NM_002046 5' TCTCTGCTCCTCCTGTTC3' 5' CTCCGACCTTCACCTTCC3'