Skip to main content

Table 1 Primers and Probe used in the study.

From: Development and evaluation of a real-time one step Reverse-Transcriptase PCR for quantitation of Chandipura Virus

Assay Primer/Probe Sequence (5' → 3') Position
P gene    
NF5 Forward Primer TGAGTGCTCTCCAACTTCTGCAGT 1682–1705
NR5 Reverse Primer TTCTTCAGAGCTTGCATCTTGAT 2331–2309
PF1 Forward Primer TTTAATCGACATGGGAGCAATTG 1953–1975
PR1 Reverse Primer TAAGGTGGGTCAGACGGAGAGA 2021–2000
PP TaqMan MGB Probe VIC-AGAATTCATCCTGGCAGCT-NFQ 1980–1998
1st PCR    
CHPNDGF3 Forward Primer TGATTCCTACATGCCCTATCT 821–841
CHPNDGR3 Reverse Primer GAACTTCTTCCCGTTAAGCACG 1078–1057
Nested 2nd PCR    
CHPNDGF4 Forward Primer TCCACGAAGTCTCCTTACTCT 863–883
CHPNDGR4 Reverse Primer GCACGAATCTCTGCTCCAGCT 1061–1041
  1. The primers and probe were located in CIN0327R (Accession no genAY614726AY614726).