Skip to main content

Table 2 PCR primers and conditions for quantitative PCR

From: Gene expression changes linked to antimicrobial resistance, oxidative stress, iron depletion and retained motility are observed when Burkholderia cenocepaciagrows in cystic fibrosis sputum

Gene Forward and reverse primer (5' – 3') Product size (bp) Tm (°C)
Real-time PCR   
Control gene BCAL1861 (phaC) AGACGGCTTCAAGGTGGT
ACACGGTGTTGACCGTCA
470 62/66
BCAL0270 GCGCGAACCCGATCGAATTC
GCCCGCATCCACCAGAAGTG
400 66
BCAM2753 GAACCGCAGACGCTGTACTC
AAACGCTCGGTGTTGCGGAC
380 62
BCAL1107 GAATCGACGTATCGGCTCGT
ATGATGTGCTTCGGGTTCTTG
377 66
BCAM1676 GACGACCTGTTCCTGCTGTG
CGGCTCTTCCTGATGACGTG
534 62
Semi-quantitative PCR   
BCAL1165 TGACGCTCGGCACCGTTGAC
GCGTGGACCTGCTCGATCTC
400 66