Molecular evidence of Ureaplasma urealyticum and Ureaplasma parvum colonization in preterm infants during respiratory distress syndrome

Table 1 Oligonucleotides employed as primers in PCR assays for detection of Mycoplasma and Ureaplasma species.

Species	Primers name (sense/antisense)	Gene targets, amplicon size (bp)	Conditions of n-PCR amplification
Mycoplasma spp. [17]	RNA5 (agagtttgatcctggctcagga)/MGSO (tgcaccatctgtcactctgttaacctc)	16S rRNA, 1005	1 cycle of 15 min. at 95°C; 30 cycles of 30 sec. at 95°C, 90 sec. at 58°C, 90 sec. plus 1 sec./cycle at 72°C; final extension of 10 min. at 72°C.
Mycoplasma spp. [17]	GPO1(actcctacgggaggcagcagta)/MGSO (tgcaccatctgtcactctgttaacctc)	16S rRNA,717
M. pneumoniae + M. genitalium [17]	PNEU+GEN (cctgcaagggttcgttattt)/MGSO (tgcaccatctgtcactctgttaacctc)	16S rRNA,851
M. hominis [17]	HOM (tgaaaggcgctgtaaggcgc)/UNI^- (taatcctgtttgctccccac)	16S rRNA,589
U. urealyticum + U. parvum [11]	UU3 (gatggtaagttagttgctgag)/UU4 (acgacgtccataagcaact)	Urease, 456	0.8 μM of each primer, MgCl₂ 1.5 mM; dNTP 0.2 mM; Taq DNA polymerase 1U/50 μl.
U. urealyticum + U. parvum [11]	UU5 (caatctgctcgtgaagtattac)/UU4 (acgacgtccataagcaact)	Urease, 429
U. urealyticum [18]	U8 (gaagatgtagaaagtcgcgtttgc)/P6 (ggtagggataccttgttacgact)	16S rRNA, 1312	1 cycle of 5 min. at 95°C; 30 cycles of 30 sec. at 95°C, 30 sec. at 58°C, 2 min 30 sec. at 72°C.
U. parvum [18]	U3 (tagaagtcgctctttgtgg)/P6 (ggtagggataccttgttacgact)	16S rRNA, 1305	1 μM of each primer, MgCl₂ 1.5 mM; dNTP 0.2 mM; Taq DNA polymerase 1.25U/50 μl.

ISSN: 1471-2334