Skip to main content

Table 1 Oligonucleotides employed as primers in PCR assays for detection of Mycoplasma and Ureaplasma species.

From: Molecular evidence of Ureaplasma urealyticum and Ureaplasma parvum colonization in preterm infants during respiratory distress syndrome

Species Primers name (sense/antisense) Gene targets, amplicon size (bp) Conditions of n-PCR amplification
Mycoplasma spp. [17] RNA5 (agagtttgatcctggctcagga)/MGSO (tgcaccatctgtcactctgttaacctc) 16S rRNA, 1005 1 cycle of 15 min. at 95°C; 30 cycles of 30 sec. at 95°C, 90 sec. at 58°C, 90 sec. plus 1 sec./cycle at 72°C; final extension of 10 min. at 72°C.
Mycoplasma spp. [17] GPO1(actcctacgggaggcagcagta)/MGSO (tgcaccatctgtcactctgttaacctc) 16S rRNA,717  
M. pneumoniae + M. genitalium [17] PNEU+GEN (cctgcaagggttcgttattt)/MGSO (tgcaccatctgtcactctgttaacctc) 16S rRNA,851  
M. hominis [17] HOM (tgaaaggcgctgtaaggcgc)/UNI- (taatcctgtttgctccccac) 16S rRNA,589  
U. urealyticum + U. parvum [11] UU3 (gatggtaagttagttgctgag)/UU4 (acgacgtccataagcaact) Urease, 456 0.8 μM of each primer, MgCl2 1.5 mM; dNTP 0.2 mM; Taq DNA polymerase 1U/50 μl.
U. urealyticum + U. parvum [11] UU5 (caatctgctcgtgaagtattac)/UU4 (acgacgtccataagcaact) Urease, 429  
U. urealyticum [18] U8 (gaagatgtagaaagtcgcgtttgc)/P6 (ggtagggataccttgttacgact) 16S rRNA, 1312 1 cycle of 5 min. at 95°C; 30 cycles of 30 sec. at 95°C, 30 sec. at 58°C, 2 min 30 sec. at 72°C.
U. parvum [18] U3 (tagaagtcgctctttgtgg)/P6 (ggtagggataccttgttacgact) 16S rRNA, 1305 1 μM of each primer, MgCl2 1.5 mM; dNTP 0.2 mM; Taq DNA polymerase 1.25U/50 μl.