Skip to main content

Table 1 An overview of the primers and probes used in the dual fluorescent multiprobe assay

From: A dual fluorescent multiprobe assay for prion protein genotyping in sheep

Primer/Probe Name Sequence (5' → 3') Length (bp) Tm (°C) avTm (°C)
Forward primer GCCTTGGTGGCTACATG 17 59.35 -
Reverse primer CTGTGATGTTGACACAGTCAT 21 59.60 -
A136-probe FAM-TGCTCATGGCACTTCCCA-BHQ1 18 62.98 56.27
V136-probe HEX-CTGCTCATGACACTTCCCAG-BHQ1 20 61.86 55.33
R154-probe TexasRed-CCGTTACTATCGTGAAAACATGTAC-BHQ2 25 61.08 56.59
H154-probe Cy5-CCGTTACTATCATGAAAACATGTACC-BHQ2 26 61.06 56.67
R171-probe FAM-CCAGTGGATCGGTATAGTAACCA-BHQ1 23 62.27 57.19
H171-probe HEX-AGACCAGTGGATCATTATAGTAACCA-BHQ1 26 61.96 57.66
Q171-probe TexasRed-CCAGTGGATCAGTATAGTAACCAGA-BHQ2 25 62.07 58.46
  1. Fluorescent labels and quenchers are in italic, SNPs are underlined. (av)Tm was calculated using Tm Utility [14].