Skip to main content

Table 2 Nucleotide base sequence of primersused for real time PCR

From: Comparison of nested PCR and real time PCR of Herpesvirus infections of central nervous system in HIV patients

Virus Region   Primer (5'-3')
HSV-1 GpD Forward CATACCGGAACGCACCACACAA
   Reverse CCATATCGACCACACCGACGA
CMV MIEA Forward AAGCGGCCTCTGATAACCAAGCC
   Reverse AGCACCATCCTCCTCTTCCTCTGG
EBV EBNA-1 Forward ATCAGGGCCAAGACATAGAGATG
   Reverse CCTTTGCAGCCAATGCAACT