Skip to main content

Table 1 Nucleotide base sequence of primers used in nested PCR

From: Comparison of nested PCR and real time PCR of Herpesvirus infections of central nervous system in HIV patients

Virus Region   Primer (5'-3')
HSV-1 GpD Outer ATCACGGTAGCCCGGCGCTGTGACA
CATACCGGAACGCACCACACAA
   Inner CCATATCGACCACACCGACGA
GGTAGTTGGTCGTTCGCGCTGAA
CMV MIEA Outer AAGCGGCCTCTGATAACCAAGCC
AGCACCATCCTCCTCTTCCTCTGG
   Inner AGTGTGGATGACCTACGGGCCATCG
GGTGACACCAGAGAATCAGAGGAGC
EBV BamH I – W Outer GAGACCGAAGTGAAGGCCCT
GGTGCCTTCTTAGGAGCTGT
   Inner GCCAGAGGTAAGTGGACTTTAAT
GAGGGGACCCTGAGACGGGT