Skip to main content

Advertisement

Table 1 ARMS primers used to type the ovine PRNP

From: A robust, low- to medium-throughput prnpgenotyping system in sheep

Name Sequence of Primer 5'-3' Allele Length/Label Fragment Length
PRNP_136A ATACATGCTGGGAAGTGC A136 18 bp/TET -
PRNP_136V CTACATGCTGGGAAGTGT V136 18 bp/FAM -
PRNP_154R ACTAACGGTACATGTTTTCAC R154 21 bp/- 92 bp
PRNP_154H AGTTTGTAACGGTACATGTTTTgAT H154 25 bp/- 96 bp
PRNP_171Q GGAAGTTGTTCTGGTTACTATcCT Q171 24 bp/- 146 bp
PRNP_171R TCAGTTAAGTTGTTCTGGTTACTATtCC R171 28 bp/- 150 bp
PRNP_171H TTCTGAGCATAAAGTTGTTCTGGTTACTATAA H171 32 bp/- 154 bp
  1. Small letters indicate deliberately introduced mismatches (ARMS principle); underlining indicate pieces of neutral sequence that were added to elongate the primer to allow allele-discrimination by capillary electrophoresis.