Skip to main content

Advertisement

Table 2 Oligonucleotide primers. Underlined bases are restriction sites relevant to the construction. MS: Mycobacterium smegmatis; MTB: Mycobacterium tuberculosis; P hsp60: promoter for the M. tuberculosis hsp60 gene. PrpsL: promoter for the M. smegmatis rpsL gene

From: I-TRAP: A method to identify transcriptional regulator activated promoters

Primer Designation Sequence 5' to 3' Gene Amplified
Ble-N ataaat ggatccaatggccaagttgaccagt ble
Ble-C aaataa ggatcctcagtcctgctcctcggc ble
TN9-5R cagggcaccggacaggtcggtc aph
981816 atgtacgtggcgaactccgttgta P hsp60
981819 gatgatatatttttatcttgtgca P hsp60
987916 gggcccaa ggatccaatggaactcctcggcggaccc MTBsigE
987917 agcgaactgggttgacgtgaactgc MTBsigE
106777 tggaactcctcggcggacc MTBsigE
106778 tgacgtgaactgcgcactcg MTBsigE
7208 tgcga gttaaccgaaccccgagcagatctacgacg MSsigE
7209 gcatctctagaagccgatcgcgtgtcggcgtc MS sigE
7206 gcatcaagctttgctctagatcggagatcgaccgtttctg MSsigE
7207 tcggt gttaaccctcggcgggcacgcggtcg MSsigE
7204 cgtga gttaacctcgcgcagcgtgggtgc aacC1
7205 gaccg gttaacggcgttgtgacaatttaccgaac aacC1
7997 cctcgacatggtgcgccg MSsigE
7998 caggcgcgaatcgtggtag MSsigE
7999 gccgtctgcccaattgcag MTBsigE
1915 gatca ggatccgatcaagagac aph
1916 gcattacacttttgttcatttcgaaccccagagtcccgctc aph
1917 agcgggactctggggttcgaaatgaacaaaggtgtaatgcg xylE
1918 ccgggccggaccatcaggtcagc xylE
5077 cgtgc tctagagcgagagtagggaactgc rRNA
5078 CGTCGT CTAGAGACGACAGGAAGAGTTTGTAG rRNA
47 CGGAGGAATCACTTCGCAATG hsp60
39A GGAGTTGAAGGCGATCTGCTT hsp60
MA1 GTGCCCGCACGCCG GGTACCATGAACTATGAGG PrpsL
MA2 CCTCATAGTTCAT GGTACCCGGCGTGCGGGCAC PrpsL
TK97L TCGA AAGCTTCGTCGCGGTCGGCCC PrpsL