Skip to main content

Table 1 Primers for PCR fragment in plasmids

From: Development of real-time NASBA assays with molecular beacon detection to quantify mRNA coding for HHV-8 lytic and latent genes

  5' primer 3' primer PCR fragment size
ORF 73 agcccaccaggagataataca tcatttcctgtggagagtccc 595 bp
vGCR gcggatatgactactctggaaact gaggctttggaagagaccgt 926 bp
vBcl-2 atggacgaggacgttttgcct cccaatagcgctgtcattct 473 bp
vIL-6 ggttcaagttgtggtctctctt ggagtcacgtctgggatagagt 589 bp