Skip to main content

Table 1 Primers and probes designed and used in this study

From: Detection of a novel avian influenza A (H7N9) virus in humans by multiplex one-step real-time RT-PCR assay

Set Primers and probes Sequences (5′ → 3′) Targeted genes Location (bp) GenBank accession no.
Designed and used in this study
FluA FluA forward GGARTGGMTAAAGACAAGACCAATC   129-153  
  FluA reverse GGCRTTYTGGACAAASCGTCTAC Matrix protein 227-249 KC885959.1
  FluA probe ROX- AGTCCTCGCTCACTGGGCACGGT-BHQ2   199-221  
H7 H7 forward GAGGCRATGCAAAATAGAATACAGAT   1510-1535  
  H7 reverse CCGAAGCTAAACCARAGTATCACA Hemagglutinin 1569-1592 KC885956.1
  H7 probe FAM- ACCCRGTCAAACTAAGCAGCGGYTAYAA-BHQ1   1538-1565  
N9 N9 forward GCCCTGATAAGCTGGCCACT   472-491  
  N9 reverse ACTAGTACTTGACCAMCCAATGCA Neuraminidase 529-552 KC885958.1
  N9 probe HEX- TCACCRCCCACAGTRTACAAYAGCA-BHQ1   496-520  
RP RP forward AGATTTGGACCTGCGAGCG   50-68  
  RP reverse GAGCGGCTGTCTCCACAAGT Ribonuclease P 71-93 NM_006413.4
  RP probe CY5- TTCTGACCTGAAGGCTCTGCGCG-BHQ2   95-114  
Designed in the World Health Organization (WHO) protocol and used in this study
FluA InfA Forward GACCRATCCTGTCACCTCTGAC   146-167  
  InfA Reverse AGGGCATTYTGGACAAAKCGTCTA Matrix protein 228-251  
  InfA Probe FAM-TGCAGTCCTCGCTCACTGGGCACG-BHQ1   201-224  
H7 CNIC-H7F GGTTTTTTCTTGTATTTTTATATGACTTAG   468-490  
  CNIC-H7R GGTTTTTTCTTGTATTTTTATATGACTTAG Hemagglutinin 521-550  
  CNIC-H7P FAM-AGATAATGCTGCATTCCCGCAGATG-BHQ1   495-519  
N9 CNIC-N9F TGGCAATGACACACACTAGTCAGT   929-952  
  CNIC-N9R ATTACCTGGATAAGGGTCGTTACACT Neuraminidase 1010-1035  
  CNIC-N9P FAM- AGACAATCCCCGACCGAATGACCC -BHQ1   975-998  
Rnase P Rnase P Forward AGATTTGGACCTGCGAGCG   50-68  
  Rnase P Reverse GAGCGGCTGTCTCCACAAGT Ribonuclease P 71-93  
  Rnase P Probe FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1   95-114  
  1. The 6th base of the FluA reverse primer was changed from “G” to “A”, the 3rd base of the H7 reverse primer was changed from “C” to “T”, and the 2nd and 23rd bases of the N9 forward primer and the 19th base of the N9 reverse primer were changed from “T” to “G”, “T” to “G”, “A” to “G”, with respect to the novel H7N9 sequences, in the WHO-recommended primers.