Skip to main content


Table 2 Oligonucleotide primers used in PCR and direct sequencing

From: Comparative evaluation of three immunochromatographic identification tests for culture confirmation of Mycobacterium tuberculosis complex

Target gene Primer ID Nucleotide sequence (5'-3') Size (bp) Ref. no.
MTC identification     
Distinguish sub-strains of BCG    
mpt64 (Rv1980c) mpb64W-F ACTCAGATATCGCGGCAATC 1061 this study
 Rv1977 Rv1977F GTTTCCCGAGATCAGCTCAA 348 this study
 Rv1981c Rv1981F GATCGAATGCAGGCTGGTAT 399 this study