Skip to main content

Table 1 Oligonucleotide primers

From: Characterization of extensively drug-resistant Mycobacterium tuberculosis isolates circulating in Siberia

Primer Nucleotide structure
ETRA1 5′-GATTGAGGGGATCGTGATTGG-3′
ETRA2 5′-AAATCGGTCCCATCACCTTCTTAT-3′
ETRB1 5′-GCGAACACCAGGACAGCATCATG-3′
ETRB2 5′-GGCATGCCGGTGATCGAGTGG-3′
ETRC1 5′-GTGAGTCGCTGCAGAACCTGCAG-3′
ETRC2 5′-GGCGTCTTGACCTCCACGAGTG-3′
MIRU02U 5′-CAGGACACGGGTTCTACTG-3′
MIRU02R 5′-GGACTAGGTCGAGGTTGTGTC-3′
MIRU04U 5′-CAGGTCACAACGAGAGGAAGAGC-3′
MIRU04R 5′-GCGGATCGGCCAGCGACTCCTC-3′
MIRU10U 5′-GACTTCCAACAGCACCGTCTTATC-3′
MIRU10R 5′-TCGCACCGATCACGCTACG-3′
MIRU16U 5′-GTTGGAAACGGCGGTTATTGAC-3′
MIRU16R 5′-CGGAGTCGTCCAGCAAGACC-3′
MIRU20U 5′-TCGGAGAGATGCCCTTCGAGTTAG -3′
MIRU20R 5′-TCACGGTCTCCGCACTAACG-3′
MIRU23U 5′-CTCACCAGGATCGCCAAACC-3′
MIRU23R 5′-TCTGACTCATGGTGTCCAACC-3′
MIRU24U 5′-GCTTGTGCGGGAAGGCTA-3′
MIRU24R 5′-CGATCGCGGATCTTTGCT-3′
MIRU26U 5′-CCAGCAGTTGAGCACAGTTCG-3′
MIRU26R 5′-GGATAGGTCCGAGTTCGATTTCC-3′
MIRU27U 5′-CGGTGACCAACGTCAGATTC-3′
MIRU27R 5′-GCGATGTGAGCGTGCCACTCAA-3′
MIRU31U 5′-CTTCGGCGTCGAAGAGAGCCTC-3′
MIRU31R 5′-CGGAACGCTGGTCACCACCTAAG-3′
MIRU39U 5′-CATCGACAAACTGGAGCCAAAC-3′
MIRU39R 5′-GAAACGTCTACGCCCCACAC-3′
MIRU40U 5′-GCAAGAGCAAGAGCACCAAGC-3′
MIRU40R 5′-TGTCTAATCAGGTCTTTCTCTCACGC-3′
MTUB30U 5′-CTTGAAGCCCCGGTCTCATCTGT-3′
MTUB30R 5′-ACTTGAACCCCCACGCCCATTAGTA-3′
MTUB39U 5′-CGGTGGAGGCGATGAACGTCTTC -3′
MTUB39R 5′-TAGAGCGGCACGGGGGAAAGCTTAG-3′
QUB4156U 5′-TGACCACGGATTGCTCTAGT-3′
QUB4156R 5′-GCCGGCGTCCATGTT-3′
V11U 5′- CGCTAGACGTCAGATCCCAG -3′
V11R 5′- GTCTGTTCCGACGCCAATAG -3′
RD105U 5′-GCTGTTTTGCTGTGGATTGTG-3′
RD105R 5′-TCACGTAGCCGCTCAAGAG-3′
RD207U 5′-GAGGATCTTCAGCAGTTGTTCTGG-3′
RD207R 5′-CTTGAAGTACTCGGAAGGTTCG-3′
RD150-1 5′-GTGCTTCGGGGATCAAGG-3′
RD150-2 5′-GGTCTATCCGCTATGTTGTGG-3′
RD181-1 5′-CTGCCGCACAACCAATG-3′
RD181-2 5′-GTGGCGACCAGATCCTTG-3′
RD150-4 5′-GTGCTTCGGGGATCAAGG-3′
RD150-3 5′-GGTCTATCCGCTATGTTGTGG-3′
RD142-U 5′-CGAGTTCAAGGCGATGTTC-3′
RD142-R 5′-GATGTGGTCGTGGTCTCC-3′
RD149-1 5′-GTAGAGGGTTTCCAGTTCCAG-3′
RD149-2 5′- GACGCCGTTGACTTGTTG -3′
RD152-3 5′-GCAGCAACCACCAGGACTC-3′
RD152-4 5′-ACATCAACGCAGCCATCG-3′
RD174-U 5′-CAAGAATCCAAGGCAGAG-3′
RD174-R 5′-CTAACAGCACAAGGTCAC-3′
RD239-1 5′-GACCAACCCTGCTCTTTCTAC-3′
RD239-2 5′-TTGGCGAGGTCTCTTGTC-3′
RD702-U 5′-GGTTGGGTGATGTCGGATTGG-3′
RD702-R 5′-CAGGCGGTCGGTGAATGC-3′
RD711-U 5′-TATCCCGATGACCAATGC-3′
RD711-R 5′-TGCGAGTGATAGATGACG-3′
RD724-U 5′-TCGTAGGGATGACTTGAC-3′
RD724-R 5′-AAGCGTGTAAAGAGGAAC-3′
RD750-1 5′-TCCACGCCAATTTCAAGG-3′
RD750-2 5′-CTCATAGATCACTCGCACAGG-3′