Skip to main content

Table 1 kdr and AChE primers

From: High frequency of kdr L1014F is associated with pyrethroid resistance in Anopheles coluzzii in Sudan savannah of northern Nigeria

  Kdr (kdr-W and kdr-E) ace-1 R
Forward primer TTGTGTTCCGTGTGCTATGC CCTGTCCGAGGACTGTCTGT
Reverse primer AAAAACGATCTTGGTCCATGT ACCACGATCACGTTCTCCTC
Sequencing primer TGTAGTGATAGGAAAT TGTGGATCTTCGGCGG
Sequence to analyse 5′-T C/T A/T GTCGTAAG-3′ 5′-C A/G GCTTCTACTCC-3′
Dispensation order for sequencing 5′-TCATcGTCGT-3′ 5′-TCAGaCTCT-3′
Product size (bp) 154 165
Allele C/T//A/T A/G