Skip to main content

Table 2 Primers used in this study

From: An analysis of microbiota-targeted therapies in patients with avian influenza virus subtype H7N9 infection

Target group Sequence (5′–3′) Annealing temperature (°C)
Faecalibacterium prausnitzii GATGGCCTCGCGTCCGATTAG 58
CCGAAGACCTTCTTCCTCC
Bifidobacterium genus GGGTGGTAATGCCGGATG 59
TAAGCCATGGACTTTCACACC
Lactic acid bacteria AGCAGTAGGGAATCTTCCA 58
ATTYCACCGCTACACATG
Enterococcus faecalis AACCTACCCATCAGAGGG 57
GACGTTCAGTTACTAACG
Enterobacteriaceae CATTGACGTTACCCGCAGAAGAAGC 63
CTCTACGAGACTCAAGCTTGC
Bacteroides-Prevotella group GAAGGTCCCCCACATTG 56
CAATCGGAGTTCTTCGTG