Skip to main content

Table 3 P. aeruginosa MLST data from the P. aeruginosa MLST database website (13 th December 2012) and associated SNP profiles for STs of national and international importance

From: A comparison of two informative SNP-based strategies for typing Pseudomonas aeruginosa isolates from patients with cystic fibrosis

20 SNP profilea MLSTb Total STs Related STs
(SLV or DLVc)
CGTCGACTACCTCCCCGGTA 649(AUST-01) d 1  
TGCAAGCTACCTTCCCGGTA 775(AUST-02) 1  
TGCAAGCTCCCCTTTGGGCG 242(AUST-03), 996 2 2/2 = SLVs
TGCCGGCTATCCCCCCGACA 787, 788(AUST-04) 2 2/2 = SLVs
TGTCGGCTACCTTTCGGGTA 209, 268, 274(AUST-05,-09, -18,-25, &-31) , 466, 546, 781(AUST-05), 936, 1043(AUST-09), 1068, 1089, 1301, 1326 12 12/12 = SLVs
CGCAAGCTATCCCCCGGGTG 4, 801 (AUST-06), 1292 3 2/3 = SLVs
CGCAAGCTATCCCCCCGGCA 262(AUST-07), 774, 1165 3 3/3 = SLVs
CGCAGGGCCCCCTTCGGGCG 782(AUST-08), 783(AUST-08), 784(AUST-08), 785(AUST-08) 4 4/4 = SLVs
CGCCGGCTCCCCCCCCGACA 179(AUST-10,-12,-14,&-26), 180, 353 3 3/3 = SLVs
TGCAAGCTACCCCCTGGACA 13, 155(AUST-10,-14, -19, &-37), 280, 541, 579, 677, 786(AUST-19), 1276, 1316, 1335 10 10/10 = SLVs
CGCAAGCTACCTCCCCGGTA 384, 1037(AUST-11) 2  
CGCAGGCTACCTCCTGGGTG 508(AUST-11), 937 2 2/2 = SLVs
TGCCGGCTCCCCCCTGGGCA 554, 804(AUST-11) 2 2/2 = SLVs
CGCAGGCTACCTCCCCGGTA 589, 791, 803(AUST-11) 3 3/3 = SLVs
TGCCGGCTATCCCCCCGGCA 822(AUST-11), 1239(M18) 2 2/2 = SLVs
CGCAAGCTACCTCCCCAGTA 882(AUST-11), 1151, 1233 3 3/3 = SLVs
CGCAGGCTACCTTCCCGGTA 1034(AUST-11) 1  
CGCAAGGTACCTCCTGGGCG 800(AUST-13) 1  
CGCAAGGTCCCCCCCGGGTG 389(AUST-13) 1  
CGTCGGCTATCCTTCCGGTA 17(AUST-15 & Clone C), 318, 322, 380, 636, 688, 845, 958, 1255, 1313 10 9/10 = SLVs
CGCAAGCTACTCTCCCGGTG 905(AUST-16), 1039 2  
CGTCGGCTATCCCCTGGGCA 398, 399, 401, 810(AUST-17) 4 3/4 = SLVs
CGTCGGCCACTCTTCCGGCG 655(AUST-20), 709 2 2/2 = SLVs
TGCAAGCTACCCTCCCGGTA 669, 808(AUST-21) 2 2/2 = SLVs
CGCCGGGCCTCCTCTGAGTG 809(AUST-22) 1  
TGTCGGCTACCTTCCCGGTA 833(AUST-23), 839 2 2/2 = SLVs
TACCAGGCCCCCTCCGAGTG 89, 307, 308(AUST-24), 662, 1028 5 2/5 = DLVs
TGTCGGCCCCCCTTCGGGTA 455(AUST-27) 1  
CGCAAGCTACCTTCCCGGTA 232, 241(AUST-28), 247, 379, 471, 577 6 5/6 = SLVs
CGTCGGCTATCCCCTGGGTA 169, 261(AUST-29) 2  
CGCAGACTCCCCTCCCGGTA 1036(AUST-30) 1  
TGCAAGCTATCCTCCCAGCG 236(AUST-32), 239, 240 3 3/3 = SLVs
TGCAAGCTATCCCCCCGGTG 12(AUST-33) 1  
CGCAAGCTCCCCCCCGGGTA 103, 244, 441, 462, 464, 594, 766, 986, 1038(AUST-34), 1181, 1227, 1338 12 10/12 = SLVs or DLVs
CGCAAGCTATCCTTCCGGTA 445, 553(AUST-35) 2  
CGCAAGCTCCTCTTTCGGTA 277(AUST-36), 364, 1128, 1390 4 4/4 = SLVs
TGTCGGCTCCTCTTTGGGTA 254(AUST-38), 1041(AUST-38) 2 2/2 = SLVs
TGTCGGCTACCTCCCCGGTG 146(LES), 374, 467, 681, 683, 970 6 6/6 = SLVs
TGCAAGCTACCTCCCCGACG 217(Manchester), 1134 2 2/2 = SLVs
CGCAAGCTACCTCCCCGGCG 386(DK2), 1244 2  
TGCAGGCTCCCCCCCCAGCA 549(PA01), 1331 2 2/2 = SLVs
TATCGGGCCCCCTCCGAGTG 65, 107, 109, 253(PA14), 297, 338, 342, 377, 532, 773, 815, 923, 1110, 1363 14 3/14 = SLVs or DLVs
CGTCGGCTCTCCCCTGGACA 1394(PACS2) 1  
CGCTAGGCCCCCTCCGAGTG 227, 230, 235(NCGM2.S1), 533, 534, 696, 745, 976, 989 9 9/9 = SLVs
CGCGGAGCCCTCTCCGTGTG 366, 368, 1006, 1063, 1190, 1191, 1195(PA7) 7 4/7 = SLVs
CGTCGGCTACCTCCCCGACA 406(Dutch-1), 484, 519, 536, 547, 575, 608, 1214, 1235, 1312, 1318 11 10/11 = SLVs or DLVs
CGTCGGCTATCCTTTGGGTA 497(Dutch-2), 544, 895, 1317 4 4/4 = SLVs or DLVs
CGCAAGCTATCCCCCGAGTA 138, 140, 148(Midlands), 956 4 2/4 = SLVs
  1. The STs consistent with recognised P. aeruginosa strains are indicated in parentheses.
  2. aSNP profile is in the order of 7, 45, 322, 381, 387, 416, 488, 881, 894, 937, 1086, 1152, 1297, 1465, 1865, 1958, 2169, 2208, 2337 and 2551. These SNPs were derived from the sequence data from the Pseudomonas aeruginosa MLST database website (http://darwin.phyloviz.net/ComparingPartitions/index.php?link=Tool) on 13 December 2012. bMLST types available from the Pseudomonas aeruginosa MLST database website (http://pubmlst.org/paeruginosa) on 13 December 2012. cSLV: single locus variant, DLV: double locus variant. dBoldface type represents previously characterised National and International MLST types of importance (e.g., AUST-01 has the MLST type 649).