Skip to main content

Table 1 Multiplex PCR on protozoa and nematodes

From: Recurrent wheezing is associated with intestinal protozoan infections in Warao Amerindian children in Venezuela: a cross-sectional survey

Name Sequence (label & quencher) Amount Target organism
Multiplex PCR on protozoa   
Crypto-tp Tex Red-ccaatcacagaatcatcagaatcgactggtatc-BHQ2 5 pmol Cryptosporidium sp.
Crypto CrF cgcttctctagccttttcatga 15 pmol  
Crypto CrR cttcacgtgtgtttgccaat 15 pmol  
Giardia-tp Fam-cccgcggcggtccctgctag-BHQ1 1 pmol G. lamblia
Giardia 80 F gacggctcaggacaacggtt 5 pmol  
Giardia 127R ttgccagcggtgtccg 5 pmol  
Df-172 Vic-caattctagccgcttat-BHQ1 5 pmol D. fragilis
Df 124-F caacggatgtcttggctcttta 14 pmol  
Df 221-R tgcattcaaagatcgaacttatcac 14 pmol  
PhHV TP Cy5-tttttatgtgtccgccaccatctggatc-BHQ2 7.5 pmol Phocine Herpes virus
PhHV-F gggcgaatcacagattgaatc 10 pmol  
PhHV-R gcggttccaaacgtaccaa 10 pmol  
Multiplex PCR on nematodes   
Ad155MGB-TP Fam-atcgtttaccgactttag-BHQ1MGB 2.5 pmol A. duodenale
Ad125F gaatgacagcaaactcgttgttg 5 pmol  
Ad195R atactagccactgccgaaacgt 5 pmol  
Na-TP Tex Red-gtgttcagcaattcccgtttaagtgaag-BHQ2 1.25 pmol N. americanus
Na58F ctgtttgtcgaacggtacttgc 5 pmol  
Na158R ataacagcgtgcacatgttgc 5 pmol  
Alum124T-TP Vic-ttggcggacaattgcatgcgat-BHQ1 1.25 pmol Ascaris sp.
Alum96F gtaatagcagtcggcggtttctt 2 pmol  
Alum183R gcccaacatgccacctattc 2 pmol  
Stro TP ATTO425-acacaccggccgtcgctgc-BHQ1 1.25 pmol S. stercoralis
Stro18s-1530F gaattccaagtaaacgtaagtcattagc 2.5 pmol  
Stro18s-1630R tgcctctggatattgctcagttc 2.5 pmol  