Skip to main content

Advertisement

Table 1 Primers used for protozoan gene amplification

From: Prevalence and genetic characterization of Cryptosporidium, Enterocytozoon, Giardia and Cyclospora in diarrheal outpatients in china

Genus Gene Sequence of primers (5´ → 3´) Amplicon size (bp)
Cryptosporidium SSUrRNA CryF1: TTCTAGAGCTAATACATGCG ~1325
CryR1: CCATTTCCTTCGAAACAGGA
CryF2: GGAAGGGTTGTATTTATTAGATAAAG ~840
CryR2: CTCATAAGGTGCTGAAGGAGTA
Microsporidia SSUrRNA EF1: GATGGTCATAGGGATGAAGAGCTT ~1200
ER1: AATACAGGATCACTTGGATCCGT
EF2: AGGGATGAAGAGCTTCGGCTCTG ~600
ER2: AATATCCCTAATACAGGATCACT
Giardia TPI TPIF1: AAATIATGCCTGCTCGTCG ~605
TPIR1: CAAACCTTITCCGCAAACC
TPIF2: CCCTTCATCGGIGGTAACTT ~530
TPIR2: GTGGCCACCACICCCGTGCC
Cyclospora 18SrRNA CYCLF1: AATGTAAAACCCTTCCAGAGTAAC ~1000
CYCLR1: GCAATA ATCTATCCCCATCACG
CYCLF2: AATTCCAGCTCCAATAGTGTAT ~500
   CYCLR2: CAGGAGAAGCCAAGGTAGGCRTTT